Reproducible Bioinformatics with Python by Ken Youens-Clark
Author:Ken Youens-Clark [Ken Youens-Clark]
Language: eng
Format: epub
Publisher: O'Reilly Media, Inc.
Published: 2021-07-24T16:00:00+00:00
>>> rna = 'AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA' >>> aa = [] >>> for codon in [rna[n:n + 3] for n in range(0, len(rna), 3)]: ... aa.append(codon_to_aa[codon]) ... >>> aa ['M', 'A', 'M', 'A', 'P', 'R', 'T', 'E', 'I', 'N', 'S', 'T', 'R', 'I', 'N', 'G', '*']
The * codon indicates where the translation should end and should not be included in the output. Your algorithm should consider that the stop codon may occur before the end of the RNA string and should halt accordingly. This should be enough hints for you to create a solution that passes the tests. Be sure to run pytest and make test to ensure your program is logically and stylistically correct.
Download
This site does not store any files on its server. We only index and link to content provided by other sites. Please contact the content providers to delete copyright contents if any and email us, we'll remove relevant links or contents immediately.
Eco-friendly approach of bio-indigo synthesis and developing purification methods towards isolation of indigo from indirubin and bacterial fragments by Ramalingam Manivannan & Kaliyan Prabakaran & Young-A Son(150861)
Whisky: Malt Whiskies of Scotland (Collins Little Books) by dominic roskrow(74270)
CONSORT 2025 statement: updated guideline for reporting randomized trials by unknow(66073)
Critical evaluation of the ProfiLER-02 study design and outcomes by Vivek Subbiah & Razelle Kurzrock(65823)
Cardiac gene therapy makes a comeback by Oliver J. Müller & Susanne Hille & Anca Kliesow Remes(65260)
Unveiling the design rules for tunable emission in graphene quantum dots: A high-throughput TDDFT and machine learning perspective by Şener Özönder & Mustafa Coşkun Özdemir & Caner Ünlü(50857)
A yeast-based oral therapeutic delivers immune checkpoint inhibitors to reduce intestinal tumor burden by unknow(34516)
Covalent hitchhikers guide proteins to the nucleus by Alexander F. Russell & Madeline F. Currie & Champak Chatterjee(34375)
Meet the Authors: Christopher R. Mansfield and Emily R. Derbyshire by Christopher R. Mansfield & Emily R. Derbyshire(34137)
What's Done in Darkness by Kayla Perrin(27103)
Topological analysis of non-conjugated ethylene oxide cored dendrimers decorated with tetraphenylethylene: Insights from degree-based descriptors using the polynomial approach by A Theertha Nair & D Antony Xavier & Annmaria Baby & S Akhila(26482)
Investigation of mechanical and self-healing properties of hydroxyl-terminated polybutadiene functionalized with 2-ureido-4-pyrimidinone by Mohsen Kazazi & Mehran Hayaty & Ali Mousaviazar(26435)
The Ultimate Python Exercise Book: 700 Practical Exercises for Beginners with Quiz Questions by Copy(21013)
De Souza H. Master the Age of Artificial Intelligences. The Basic Guide...2024 by Unknown(20773)
D:\Jan\FTP\HOL\Work\Alien Breed - Tower Assault CD32 Alien Breed II - The Horror Continues Manual 1.jpg by PDFCreator(20647)
The Fifty Shades Trilogy & Grey by E L James(19604)
Shot Through the Heart: DI Grace Fisher 2 by Isabelle Grey(19486)
Shot Through the Heart by Mercy Celeste(19345)
Wolf & Parchment: New Theory Spice & Wolf, Vol. 10 by Isuna Hasekura and Jyuu Ayakura(17490)